nelf

Ensembl ID:
ENSDARG00000061506
ZFIN ID:
ZDB-GENE-080603-4
Description:
nasal embryonic LHRH factor [Source:RefSeq peptide;Acc:NP_001137373]
Human Orthologue:
NELF
Human Description:
nasal embryonic LHRH factor [Source:HGNC Symbol;Acc:29843]
Mouse Orthologue:
Nelf
Mouse Description:
nasal embryonic LHRH factor Gene [Source:MGI Symbol;Acc:MGI:1861755]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33616 Nonsense Mutation detected in F1 DNA During 2017
sa38476 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40442 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087763 Nonsense 116 568 3 14
ENSDART00000129031 Nonsense 116 570 3 15
ENSDART00000139253 Nonsense 116 297 3 4
Genomic Location (Zv9):
Chromosome 5 (position 30089067)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27844365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTCCAAGCGGCGGCTCTCCGTAGAACGCAGCCTTTCTTCTGAGGAT[C/T]AGCAGAATCAGAGGCGTACCGAGAGTTCTGTGAAGCCAGCACGTGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087763 Essential Splice Site 315 568 5 14
ENSDART00000129031 Essential Splice Site 317 570 6 15
ENSDART00000139253   None 297 None 4
Genomic Location (Zv9):
Chromosome 5 (position 30103936)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27859134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGGAAACATCTGAGGATGGTGGGCAGCAGGAGGGTGAAGGCCCAGAG[T/A]GAGTTGTTTGTAGACATCTTTATGTGTGTTTGTGTTACAGAGTGAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087763 Nonsense 436 568 10 14
ENSDART00000129031 Nonsense 438 570 11 15
ENSDART00000139253   None 297 None 4
Genomic Location (Zv9):
Chromosome 5 (position 30110922)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27866120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCATCTTTCCCCTCTTCAGAGGAGATTGAAAAGAAACTCACCGCCTA[C/A]AGAAAAGGCTGCAAAATCTGGAACATGCTCATCTTCTGTCAGGTTTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link