THSD7B (2 of 2)

Ensembl ID:
ENSDARG00000061497
Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Human Orthologue:
THSD7B
Human Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Mouse Orthologue:
Thsd7b
Mouse Description:
thrombospondin, type I, domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2443925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21942 Nonsense Mutation detected in F1 DNA During 2014
sa4426 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 209 1573 1 29
Genomic Location:
Chromosome 11 (position 34513855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGGGGTGGCACCTGTTGGGAAAACAACAGTGGATTTTAATTTGGGG[A/T]AAAGTACAGTCAGGACTTCCTATACAATAAAGCGGCACGCGGAAGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 1190 1573 20 29
Genomic Location:
Chromosome 11 (position 34591173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGAACTGYRTGCGCAGTGATGGGAAACTGGTGGAGCTCAGCCTGTGC[A/T]AAGAGGTGACTGTGCWTTTCTCAGTGGAATCCCCWGTAGGAATGCAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fbm69u37