THSD7B (2 of 2)

Ensembl ID:
ENSDARG00000061497
Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Human Orthologue:
THSD7B
Human Description:
thrombospondin, type I, domain containing 7B [Source:HGNC Symbol;Acc:29348]
Mouse Orthologue:
Thsd7b
Mouse Description:
thrombospondin, type I, domain containing 7B Gene [Source:MGI Symbol;Acc:MGI:2443925]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21942 Nonsense Mutation detected in F1 DNA During 2016
sa35123 Nonsense Mutation detected in F1 DNA During 2016
sa41879 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31841 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4426 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 209 1573 1 29
Genomic Location:
Chromosome 11 (position 34513855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGGGGTGGCACCTGTTGGGAAAACAACAGTGGATTTTAATTTGGGG[A/T]AAAGTACAGTCAGGACTTCCTATACAATAAAGCGGCACGCGGAAGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 473 1573 6 29
Genomic Location:
Chromosome 11 (position 34535199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTCGCAGGTTTCAAGATTAGAAGTCGTTCTGTAATTACGGAGTCTTG[G/A]GTCGAGTCTGACAGTTGCCCTCACGTCAGCGAAGCAATGACCTGCGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Essential Splice Site 671 1573 8 29
Genomic Location:
Chromosome 11 (position 34561292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGTCATATGCAGGAGGGCTGGGAATGGACATGTGCTGCCAAAACGG[T/C]AAAGAAGCACAAAAATCTTACAGACTAACTCTTGTTCAGGCTTCTATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Essential Splice Site 896 1573 14 29
Genomic Location:
Chromosome 11 (position 34576738)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCAGTGAAGAGCACTGCTGGACGGCCTTTCATCCAAGGAGTTTTCC[A/G]CCAAGGCCAGAAGGCAGTCCAGGACTGGCGAGGCCTTAGGAGGAGCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087690 Nonsense 1190 1573 20 29
Genomic Location:
Chromosome 11 (position 34591173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGAACTGYRTGCGCAGTGATGGGAAACTGGTGGAGCTCAGCCTGTGC[A/T]AAGAGGTGACTGTGCWTTTCTCAGTGGAATCCCCWGTAGGAATGCAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link