si:dkey-181m9.9

Ensembl ID:
ENSDARG00000061490
ZFIN ID:
ZDB-GENE-070912-400
Description:
U2-associated SR140 protein-like [Source:RefSeq peptide;Acc:NP_001184003]
Human Orthologue:
AC018450.1
Human Description:
U2-associated protein SR140 [Source:UniProtKB/Swiss-Prot;Acc:O15042]
Mouse Orthologue:
2610101N10Rik
Mouse Description:
RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25819 Nonsense Mutation detected in F1 DNA During 2017
sa39842 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32928 Nonsense Mutation detected in F1 DNA During 2017
sa1800 Missense F2 line generated During 2017
sa30820 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39841 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Nonsense 359 750 9 18
ENSDART00000132651 Nonsense 577 923 17 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26779217)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26975413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATATTTTCTGACCTAAATGCTACTTATAAGACAATACAGGGCCATTTA[C/T]AATCAGAAAATTTTAAGGTAAGCGGTCTGTCTCTTAAATTTAACACACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Essential Splice Site 364 750 9 18
ENSDART00000132651 Essential Splice Site 582 923 17 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26779199)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26975395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTACTTATAAGACAATACAGGGCCATTTACAATCAGAAAATTTTAAG[G/A]TAAGCGGTCTGTCTCTTAAATTTAACACACTTTTCGTCTACACTTTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Nonsense 547 750 14 18
ENSDART00000132651 Nonsense 765 923 22 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26775427)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26971623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTGCTGCGGACCAGCAGTCCTACAGTAATCCTGTTAGAGAAGAGTA[T/A]GATTTAAAGTCTGCAAAGTTTTCTGAGACGAGCGAGGAGAAGCGTGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1800
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Missense 642 750 16 18
ENSDART00000132651 Missense 860 923 24 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26772857)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26969053
KASP Assay ID:
554-1792.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACAAAGAGAAATCGGACGTGTTCCACAAAGAGAAAGACAAAGATGAA[T/A]CCACACCGGGTAGAAAAGAAAAGTAAGAGGAGATCTCAAATATTTCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Essential Splice Site 705 750 None 18
ENSDART00000132651   None 923 25 25
ENSDART00000132854   None 277 None 9
ENSDART00000087714 Essential Splice Site 705 750 None 18
ENSDART00000132651   None 923 25 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26772043)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26968239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATACCTCGTTACACTCAACCTAATGTCTTGTTTTTAAATGTGATTTC[A/T]GATCTCCTTCACCTCCAAGAACCCCCAAGAGGTCGCGCAGATCCAGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087714 Essential Splice Site 705 750 None 18
ENSDART00000132651   None 923 25 25
ENSDART00000132854   None 277 None 9
ENSDART00000087714 Essential Splice Site 705 750 None 18
ENSDART00000132651   None 923 25 25
ENSDART00000132854   None 277 None 9

The following transcripts of ENSDARG00000061490 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26772043)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26968239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATACCTCGTTACACTCAACCTAATGTCTTGTTTTTAAATGTGATTTC[A/T]GATCTCCTTCACCTCCAAGAACCCCCAAGAGGTCGCGCAGATCCAGATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link