ENSDARG00000061481

Ensembl ID:
ENSDARG00000061481
Human Orthologue:
FRRS1
Human Description:
ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
Mouse Orthologue:
Frrs1
Mouse Description:
ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30118 Nonsense Mutation detected in F1 DNA During 2015
sa11026 Nonsense Available for shipment Available now
sa19343 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa30118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087724 Nonsense 85 570 2 15
Genomic Location:
Chromosome 24 (position 30758927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAACGCTAAATAGCCAAACGGGATATTACTTTGAAGGCTTTATGTTG[C/T]AAGCACGCCCAGTTGGATCGAGCAGTACCATTGGCACTTTTTCTGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11026
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087724 Nonsense 459 570 11 15
ENSDART00000087724 Nonsense 459 570 11 15
Genomic Location:
Chromosome 24 (position 30745330)
KASP Assay ID:
554-6210.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTTTGGTGATGATCCTCAGTCTCATTCAGCCCATCGTCGCTGCTTTC[C/T]GATGTGAGCCGCAACATGAACGGTGAGAATATAACCANNGCTATGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087724 Nonsense 459 570 11 15
ENSDART00000087724 Nonsense 459 570 11 15
Genomic Location:
Chromosome 24 (position 30745330)
KASP Assay ID:
554-6210.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTGGTGATGATCCTCAGTCTCATTCAGCCCATCGTCGCTGCTTTC[C/T]GATGTGAGCCGCAACATGAACGGTGAGAATATAACCATAGCTATGTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lkb8f27a