si:ch211-132b12.1

Ensembl ID:
ENSDARG00000061480
ZFIN ID:
ZDB-GENE-050420-315
Description:
hypothetical protein LOC100034467 [Source:RefSeq peptide;Acc:NP_001076533]
Human Orthologues:
SLC6A11, SLC6A12, SLC6A13
Human Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 [Source:HGNC Symbol;
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 [Source:HGNC Symbol;Acc:1104
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 [Source:HGNC Symbol;Acc:1104
Mouse Orthologues:
Slc6a11, Slc6a12, Slc6a13
Mouse Descriptions:
solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12 Gene [Source:MGI Sym
solute carrier family 6 (neurotransmitter transporter, GABA), member 11 Gene [Source:MGI Symbol;Acc:
solute carrier family 6 (neurotransmitter transporter, GABA), member 13 Gene [Source:MGI Symbol;Acc:

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16967 Nonsense Available for shipment Available now
sa15976 Nonsense Available for shipment Available now
sa13216 Essential Splice Site Available for shipment Available now
sa2964 Essential Splice Site F2 line generated During 2017
sa1085 Nonsense F2 line generated During 2017
sa986 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16967
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 77 586 2 14
Genomic Location (Zv9):
Chromosome 18 (position 38850048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40562765
KASP Assay ID:
2261-2496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGGGTGCCTCTGTTTTTGCTGGAGATGGCTATGGGACAGTACACTCAG[C/T]AAGGGGGTGYWACGTGCTGGCATCGCCTCTGTCCACTTGCTGAGGGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 240 586 6 14
Genomic Location (Zv9):
Chromosome 18 (position 38852187)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40564904
KASP Assay ID:
2261-2498.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGCTGCTTGTGTTGYTGATYCRTGGRWTGACTCTTCCTGGAGCTCTK[C/T]AGGGGGTTGTGTTTTATCTGTACCCTGAACCGRCCCGTCTTGCTGWTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Essential Splice Site 257 586 6 14
Genomic Location (Zv9):
Chromosome 18 (position 38852242)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40564959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGTGTTTTATCTGTACCCTGAACCGGCCCGTCTTGCTGWTCCACAGG[T/A]AACTCCACATAACAAGACACTGACWGTGTCATATTTTAWTGTWCTAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2964
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Essential Splice Site 371 586 9 14
Genomic Location (Zv9):
Chromosome 18 (position 38855982)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40568699
KASP Assay ID:
554-2951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGTTTGTTTCTTCATCATGATTATTTTRCTAGGCCTAGATACACAGG[T/C]AATTTTAAACTAACACATGTACAACAAAACAATAGATATATTTACAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1085
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 407 586 10 14
Genomic Location (Zv9):
Chromosome 18 (position 38858050)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40570767
KASP Assay ID:
554-0987.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGAGAAGGACGGCGAGAAATCTTACTCCTGTTCTTTTGTCTCACTTG[C/A]TTCTTTGGCCAATTCATCATGGTTACAGAGGTTAGAAGCGTGCGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087699 Nonsense 532 586 13 14
Genomic Location (Zv9):
Chromosome 18 (position 38859333)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40572050
KASP Assay ID:
554-0890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTACTGGCTCTGTCMTCCATTGTGCTTGTGCCTGGATGGGCACTGGGC[C/T]GACTGTGCWCTGAAAAGGGGAGTTTAAAACAGGTTAGGATGTTTATCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link