thsd7a

Ensembl ID:
ENSDARG00000061479
ZFIN ID:
ZDB-GENE-060503-709
Description:
thrombospondin type-1 domain-containing protein 7A [Source:RefSeq peptide;Acc:NP_001116232]
Human Orthologue:
THSD7A
Human Description:
thrombospondin, type I, domain containing 7A [Source:HGNC Symbol;Acc:22207]
Mouse Orthologue:
Thsd7a
Mouse Description:
thrombospondin, type I, domain containing 7A Gene [Source:MGI Symbol;Acc:MGI:2685683]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15977 Nonsense Available for shipment Available now
sa8458 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19218 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087694 Nonsense 17 1634 1 26
ENSDART00000123812 Nonsense 67 293 2 2
ENSDART00000126447 Nonsense 17 1589 1 31
Genomic Location:
Chromosome 19 (position 39250394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGACCATGGGGAAGGTGTATGGGTAGTGAGTGTGGTCCGGGAGGAAGT[C/T]AAAGCCGAGCAGTATGGTGTGCCCACTCTGAAGGCTGGACAACRTTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8458
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087694 Essential Splice Site 459 1634 3 26
ENSDART00000123812 None None 293 None 2
ENSDART00000126447 None None 1589 None 31
Genomic Location:
Chromosome 19 (position 39269190)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCCCAAGYGAAACCTCATCCAACCTCGGCTCCCTCAAGAGCAAAGACG[G/A]TAACAAAACTGGCACATTCATTGTCTTAAMCTTCTGCTTGATTGCAAGYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087694 None None 1634 None 26
ENSDART00000123812 None None 293 None 2
ENSDART00000126447 Nonsense 725 1589 13 31
Genomic Location:
Chromosome 19 (position 39328797)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTATTAGATTCACATATTTATGGATGCTTTCACAGGATGGAGATTT[T/A]GAAAGTATGAATCACTGAACCAAGTTTATAAAAAAATCTAAAAAACAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4a6xqwhu