igf2bp1

Ensembl ID:
ENSDARG00000061478
ZFIN ID:
ZDB-GENE-060929-1258
Description:
Insulin-like growth factor 2 mRNA-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q08CK7]
Human Orthologue:
IGF2BP1
Human Description:
insulin-like growth factor 2 mRNA binding protein 1 [Source:HGNC Symbol;Acc:28866]
Mouse Orthologue:
Igf2bp1
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890357]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18628 Essential Splice Site Available for shipment Available now
sa19995 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087726 Essential Splice Site 95 598 4 16
Genomic Location (Zv9):
Chromosome 3 (position 23836086)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23414297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGAAAACTTCAGATCAGAAACATTCCACCACACCTGCAGTGGGAGG[T/C]GAGTCTTGGTGTGTTTGTCATGCCGACAGTAAGACYTCCTACAGTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087726 Nonsense 399 598 11 16
Genomic Location (Zv9):
Chromosome 3 (position 23821346)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23399557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCATGCCGCCTCCTGCCCTCGGAAACTCTGTGCCTGGTCCCCCTTA[T/A]GGCCCTATGGGGGTATGACACATTTTGTCCTTTTCATCATTTGATAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link