igf2bp1

Ensembl ID:
ENSDARG00000061478
ZFIN ID:
ZDB-GENE-060929-1258
Description:
Insulin-like growth factor 2 mRNA-binding protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q08CK7]
Human Orthologue:
IGF2BP1
Human Description:
insulin-like growth factor 2 mRNA binding protein 1 [Source:HGNC Symbol;Acc:28866]
Mouse Orthologue:
Igf2bp1
Mouse Description:
insulin-like growth factor 2 mRNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1890357]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18628 Essential Splice Site Available for shipment Available now
sa5197 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19995 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18628
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087726 Essential Splice Site 95 598 4 16
Genomic Location:
Chromosome 3 (position 23836086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCAGAAAACTTCAGATCAGAAACATTCCACCACACCTGCAGTGGGAGG[T/C]GAGTCTTGGTGTGTTTGTCATGCCGACAGTAAGACYTCCTACAGTTATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087726 Essential Splice Site 276 598 8 16
Genomic Location:
Chromosome 3 (position 23827339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGAATGATCCTGGAAATCATGAACCAGGAGGCCAAGGACACCAAAACG[T/C]GAGTATGATGGTGGTTGTCTTAAWATGGACAGTTTTGGATTTCAGTCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087726 Nonsense 399 598 11 16
Genomic Location:
Chromosome 3 (position 23821346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCATGCCGCCTCCTGCCCTCGGAAACTCTGTGCCTGGTCCCCCTTA[T/A]GGCCCTATGGGGGTATGACACATTTTGTCCTTTTCATCATTTGATAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zymvbluf