LOC559568

Ensembl ID:
ENSDARG00000061473
Human Orthologue:
TBKBP1
Human Description:
TBK1 binding protein 1 [Source:HGNC Symbol;Acc:30140]
Mouse Orthologue:
Tbkbp1
Mouse Description:
TBK1 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920424]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22118 Nonsense Mutation detected in F1 DNA During 2016
sa42048 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16147 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087696 Nonsense 27 632 1 9
Genomic Location:
Chromosome 12 (position 30165459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGGGGGCAGCGAGGGTCTGAAAGAAGACGGCTGCGGGGTGGGCTG[G/A]TCCAACTCTCCCTTATCAGACGACATGTATTCGGCCTCCCAATTCGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087696 Essential Splice Site 75 632 1 9
Genomic Location:
Chromosome 12 (position 30165605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGAAAACGCAGACATCAAGCGAAAACTCAAGATTTATGAGATAAAGG[T/A]AGGAAATGGCTTAAAGATGCTTTAGTTTCAGATAGGAGATATCAGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087696 Nonsense 456 632 8 9
Genomic Location:
Chromosome 12 (position 30216518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATACGTTGACAGCTACCACAAGCAGCAGCAGCAACAGCAGCAGCAA[C/T]AACAACAGCAACACGGAGGAAGCCAGCACATGTTAGTTCAGAGACAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link