LOC559568

Ensembl ID:
ENSDARG00000061473
Human Orthologue:
TBKBP1
Human Description:
TBK1 binding protein 1 [Source:HGNC Symbol;Acc:30140]
Mouse Orthologue:
Tbkbp1
Mouse Description:
TBK1 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920424]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22118 Nonsense Mutation detected in F1 DNA During 2014
sa16147 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087696 Nonsense 27 632 1 9
Genomic Location:
Chromosome 12 (position 30165459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGGGGGCAGCGAGGGTCTGAAAGAAGACGGCTGCGGGGTGGGCTG[G/A]TCCAACTCTCCCTTATCAGACGACATGTATTCGGCCTCCCAATTCGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087696 Nonsense 456 632 8 9
Genomic Location:
Chromosome 12 (position 30216518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATACGTTGACAGCTACCACAAGCAGCAGCAGCAACAGCAGCAGCAA[C/T]AACAACAGCAACACGGAGGAAGCCAGCACATGTTAGTTCAGAGACAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ankylosing spondylitis: Interaction between ERAP1 and HLA-B27 in ankylosing spondylitis implicates peptide handling in the mechanism for HLA-B27 in disease susceptibility. (View Study)
  • Multiple sclerosis: Genome-wide meta-analysis identifies novel multiple sclerosis susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/490nh3ug