ncaph

Ensembl ID:
ENSDARG00000061468
ZFIN ID:
ZDB-GENE-070112-652
Description:
condensin complex subunit 2 [Source:RefSeq peptide;Acc:NP_001073665]
Human Orthologue:
NCAPH
Human Description:
non-SMC condensin I complex, subunit H [Source:HGNC Symbol;Acc:1112]
Mouse Orthologue:
Ncaph
Mouse Description:
non-SMC condensin I complex, subunit H Gene [Source:MGI Symbol;Acc:MGI:2444777]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31444 Nonsense Available for shipment Available now
sa20434 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087684 Nonsense 22 690 2 18
Genomic Location (Zv9):
Chromosome 5 (position 29904776)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27660074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCCCGACCGCCCGGCAACGGCAGTGGTCCTCTCCGGCACTGGGCCAC[A/T]AAGCCGCACTGTCCACCACCAGCACACCTCTGCTGGACAACATTCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087684 Essential Splice Site 672 690 18 18
Genomic Location (Zv9):
Chromosome 5 (position 29914930)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27670228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGTGTATTTAATTGCTGTGAATCTAAAAGTGGTTCTTTCCATCAAC[A/T]GAACTTGGAGCTGCACAAAATTGATGGCATGACTGATATCATCATTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link