si:ch211-180j19.1

Ensembl ID:
ENSDARG00000061466
ZFIN ID:
ZDB-GENE-081105-9
Description:
hypothetical protein LOC568003 [Source:RefSeq peptide;Acc:NP_001116758]
Human Orthologue:
CPNE5
Human Description:
copine V [Source:HGNC Symbol;Acc:2318]
Mouse Orthologue:
Cpne5
Mouse Description:
copine V Gene [Source:MGI Symbol;Acc:MGI:2385908]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34398 Nonsense Mutation detected in F1 DNA During 2017
sa25394 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41201 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087656 Nonsense 5 569 1 21
ENSDART00000143152   None 563 None 20
Genomic Location (Zv9):
Chromosome 8 (position 24798571)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23924389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTAAATGAAAATTATAAAACTGTCACACAACTGGTAGACATAACCTA[C/A]TGTAGCCTGCTTGAAGTATTTTCTTGCTCACAAAAGTAAACAGTTTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087656 Essential Splice Site 51 569 3 21
ENSDART00000143152 Essential Splice Site 46 563 2 20
Genomic Location (Zv9):
Chromosome 8 (position 24799723)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23925541
KASP Assay ID:
554-7389.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCAGAAACCTGTTAGATCGTGACACATTCTCCAAGTCGGATCCTTG[T/G]AAGTATCTCTCTTTTTCATGGCTGAAGCATTTATTTTTGAAGCCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087656 Essential Splice Site 114 569 6 21
ENSDART00000143152 Essential Splice Site 109 563 5 20
Genomic Location (Zv9):
Chromosome 8 (position 24812848)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23938666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATTTCAGATATGACATTGACTCCAAAAGTCCGGATTTGGCCAAACAC[G/A]TAAGTGTAGCACTTTGTATGTGTGTGTATACTGTGAATGCATGCATGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link