si:ch73-235d11.1

Ensembl ID:
ENSDARG00000061462
ZFIN ID:
ZDB-GENE-060503-234
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L860]
Human Orthologue:
C6orf27
Human Description:
chromosome 6 open reading frame 27 [Source:HGNC Symbol;Acc:13939]
Mouse Orthologue:
D17H6S56E-3
Mouse Description:
DNA segment, Chr 17, human D6S56E 3 Gene [Source:MGI Symbol;Acc:MGI:1306798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087664 Nonsense 980 1010 16 16
ENSDART00000132833   None 497 None 10
Genomic Location (Zv9):
Chromosome 18 (position 38845586)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40558303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTAATATGAGACGCTGTCATCTCAAAGCTAGTCAGCAGAGGGCACTA[C/T]GAGAAAACAACAGKGCACACAGTGGGGAATCTACCTCWTGKTTACCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link