dsel

Ensembl ID:
ENSDARG00000061461
ZFIN ID:
ZDB-GENE-030131-7517
Description:
Novel protein similar to vertebrate dermatan sulfate epimerase-like (DSEL) [Source:UniProtKB/TrEMBL;
Human Orthologue:
DSEL
Human Description:
dermatan sulfate epimerase-like [Source:HGNC Symbol;Acc:18144]
Mouse Orthologue:
Dsel
Mouse Description:
dermatan sulfate epimerase-like Gene [Source:MGI Symbol;Acc:MGI:2442948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1457 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087687 Nonsense 310 1191 1 1
Genomic Location (Zv9):
Chromosome 2 (position 27462681)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27658877
KASP Assay ID:
554-1382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTAGAGCTCATTTTATGTTTTACTTCGCCACTCTGCTTCCTGGATTT[C/T]AAAGAACTGTTGGCATCGCAGACTCTAATTACAACTGGTTCTATGGGCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link