nrxn2a

Ensembl ID:
ENSDARG00000061454
ZFIN ID:
ZDB-GENE-070206-5
Description:
neurexin 2a [Source:RefSeq peptide;Acc:NP_001073439]
Human Orthologue:
NRXN2
Human Description:
neurexin 2 [Source:HGNC Symbol;Acc:8009]
Mouse Orthologue:
Nrxn2
Mouse Description:
neurexin II Gene [Source:MGI Symbol;Acc:MGI:1096362]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32351 Nonsense Available for shipment Available now
sa16817 Essential Splice Site Available for shipment Available now
sa18390 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Nonsense 455 1670 9 24
ENSDART00000087660   None 642 None 7
ENSDART00000132583   None 648 None 7
ENSDART00000141629 Nonsense 455 1670 10 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27473300)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28042211
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTCCCTGTCCCAGGTGGTCTACACCAATAATGAGTTCAGACTA[G/T]AGCTCTCCCATCTGGCGGAATTGCGTGACCCTAAGGTTACCCTCCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Essential Splice Site 962 1670 15 24
ENSDART00000087660   None 642 None 7
ENSDART00000132583   None 648 None 7
ENSDART00000141629 Essential Splice Site 962 1670 15 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27445497)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28014408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACTCTGGGGATGGCAGTGACTTTATCGTGATYGAGCTTGTAAAAGGG[T/A]AAGTGTGAGTTTTAATTGAACAATTTTAACAAATAATACAGGGTTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087657 Nonsense 1080 1670 17 24
ENSDART00000087660   None 642 None 7
ENSDART00000132583   None 648 None 7
ENSDART00000141629 Nonsense 1080 1670 17 24

The following transcripts of ENSDARG00000061454 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 27407096)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 27976007
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTTCAGACCTGATTGCAGATGCTCTGCACCGTGTKGGCCAAGTGGAG[C/T]GAGGATGTGAGGGTCAGTATACTGATGCTCTGAGGCAATCATGACAACAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Urate levels: Genome-wide association study for serum urate concentrations and gout among African Americans identifies genomic risk loci and a novel URAT1 loss-of-function allele. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link