n4bp2

Ensembl ID:
ENSDARG00000061451
ZFIN ID:
ZDB-GENE-061103-451
Description:
NEDD4-binding protein 2 [Source:RefSeq peptide;Acc:NP_001073436]
Human Orthologue:
N4BP2
Human Description:
NEDD4 binding protein 2 [Source:HGNC Symbol;Acc:29851]
Mouse Orthologue:
N4bp2
Mouse Description:
NEDD4 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2684414]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32668 Nonsense Mutation detected in F1 DNA During 2017
sa19497 Essential Splice Site Available for shipment Available now
sa32669 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19498 Nonsense Available for shipment Available now
sa32670 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087658 Nonsense 222 1691 2 16

The following transcripts of ENSDARG00000061451 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22147799)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22682966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATCTCAGCCTCAATGTCCAGCTCCCCAAAGCTTAGCAGAGCATGCT[G/T]AGCACGTCTCTTACTCTGACCCTGGGCTCAGTGAGGCTCGTGGTGGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087658 Essential Splice Site 467 1691 4 16

The following transcripts of ENSDARG00000061451 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22150025)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22685192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAACACCAATACGCAATGTTGGGAGATGAAACCATACGTTGCCATGG[T/C]GAGCACTGTATGATGAAACGCATATGAATTACTATTCAGTCTCACTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087658 Essential Splice Site 493 1691 5 16

The following transcripts of ENSDARG00000061451 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22150568)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22685735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCGTGAGCCAGATACCTGGTGGAAGACTAAACCTAGGGAGCTGGAGAA[G/A]TATGTTAAACATGACCACAAACCACACATTTTTACCTTTATAATACTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087658 Nonsense 513 1691 6 16

The following transcripts of ENSDARG00000061451 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22150843)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22686010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACCAGGTTACAAAGGAGAAGATTAGACGCATGTTAGAAAGGTATGAC[C/T]GATTTGTCTCTGTCCAGACCATCATGAATTCAAATAAACCAGAACCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087658 Essential Splice Site 544 1691 7 16

The following transcripts of ENSDARG00000061451 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 22151141)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22686308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAATTATTTGTATTTAAACAACTATGGGGATACCCGTCTTTTTTTTC[A/T]GGCAGTTTTTACACCCTGGCCTCAGTCATCCTGATCTTGTTGGTGACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link