ugt5c1

Ensembl ID:
ENSDARG00000061444
ZFIN ID:
ZDB-GENE-050419-68
Description:
UDP glucuronosyltransferase 5 family, polypeptide C1 [Source:RefSeq peptide;Acc:NP_001170966]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12147 Nonsense Available for shipment Available now
sa23360 Nonsense Available for shipment Available now
sa39211 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa12147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129141 Nonsense 108 531 2 2
ENSDART00000143713 Nonsense 108 531 1 1
Genomic Location (Zv9):
Chromosome 18 (position 38757544)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40470261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATGTGCTGACTAAAAAGATTGACTATGAAAGAGGTAAGGGCTCCTG[G/A]CTGGGTRGTGTACAGCTGTTTTTGGATGTATCCAAAGCTGTTTATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129141 Nonsense 176 531 2 2
ENSDART00000143713 Nonsense 176 531 1 1
Genomic Location (Zv9):
Chromosome 18 (position 38757748)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40470465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGTACAGGTATTATTCTGGCTCATAAACTCAAGTTACCCATGGTCTA[T/A]AATGTGAGATGGACTACTCCTGGAGAAGGACACTTTGACATCGCTCCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129141 Nonsense 454 531 2 2
ENSDART00000143713 Nonsense 454 531 1 1
Genomic Location (Zv9):
Chromosome 18 (position 38758580)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40471297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATGAGCCATCCTACAGGCTGAATATGCAGAAGCTCTCTTATCTGCAC[A/T]GAGACAAGCCAGTCGAACCGTTGGACAGCGCCATCTTCTGGATTGAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link