Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ugt5c1
- Ensembl ID:
- ENSDARG00000061444
- ZFIN ID:
- ZDB-GENE-050419-68
- Description:
- UDP glucuronosyltransferase 5 family, polypeptide C1 [Source:RefSeq peptide;Acc:NP_001170966]
- Human Orthologue:
- UGT8
- Human Description:
- UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
- Mouse Orthologue:
- Ugt8a
- Mouse Description:
- UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]
Alleles
There are 3 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa12147 | Nonsense | Available for shipment | Available now |
| sa23360 | Nonsense | Available for shipment | Available now |
| sa39211 | Nonsense | Mutation detected in F1 DNA | During 2017 |
Mutation Details
- Allele Name:
- sa12147
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000129141 | Nonsense | 108 | 531 | 2 | 2 |
| ENSDART00000143713 | Nonsense | 108 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38757544)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40470261 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGATGTGCTGACTAAAAAGATTGACTATGAAAGAGGTAAGGGCTCCTG[G/A]CTGGGTRGTGTACAGCTGTTTTTGGATGTATCCAAAGCTGTTTATGAAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23360
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000129141 | Nonsense | 176 | 531 | 2 | 2 |
| ENSDART00000143713 | Nonsense | 176 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38757748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40470465 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGGTACAGGTATTATTCTGGCTCATAAACTCAAGTTACCCATGGTCTA[T/A]AATGTGAGATGGACTACTCCTGGAGAAGGACACTTTGACATCGCTCCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39211
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000129141 | Nonsense | 454 | 531 | 2 | 2 |
| ENSDART00000143713 | Nonsense | 454 | 531 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 18 (position 38758580)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 40471297 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAATGAGCCATCCTACAGGCTGAATATGCAGAAGCTCTCTTATCTGCAC[A/T]GAGACAAGCCAGTCGAACCGTTGGACAGCGCCATCTTCTGGATTGAGTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
