ugt5c1

Ensembl ID:
ENSDARG00000061444
ZFIN ID:
ZDB-GENE-050419-68
Description:
UDP glucuronosyltransferase 5 family, polypeptide C1 [Source:RefSeq peptide;Acc:NP_001170966]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12147 Nonsense Available for shipment Available now
sa23360 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129141 Nonsense 108 531 2 2
ENSDART00000143713 Nonsense 108 531 1 1
Genomic Location:
Chromosome 18 (position 38757544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGATGTGCTGACTAAAAAGATTGACTATGAAAGAGGTAAGGGCTCCTG[G/A]CTGGGTRGTGTACAGCTGTTTTTGGATGTATCCAAAGCTGTTTATGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129141 Nonsense 176 531 2 2
ENSDART00000143713 Nonsense 176 531 1 1
Genomic Location:
Chromosome 18 (position 38757748)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGGTACAGGTATTATTCTGGCTCATAAACTCAAGTTACCCATGGTCTA[T/A]AATGTGAGATGGACTACTCCTGGAGAAGGACACTTTGACATCGCTCCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ktzsaw2n