inpp5f

Ensembl ID:
ENSDARG00000061437
ZFIN ID:
ZDB-GENE-041111-194
Description:
Phosphatidylinositide phosphatase SAC2 [Source:UniProtKB/Swiss-Prot;Acc:A8E7C5]
Human Orthologue:
INPP5F
Human Description:
inositol polyphosphate-5-phosphatase F [Source:HGNC Symbol;Acc:17054]
Mouse Orthologue:
Inpp5f
Mouse Description:
inositol polyphosphate-5-phosphatase F Gene [Source:MGI Symbol;Acc:MGI:2141867]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22302 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22303 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18211 Nonsense Available for shipment Available now
sa9903 Nonsense Available for shipment Available now
sa8676 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22304 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Essential Splice Site 33 1126 2 20
ENSDART00000140634 Essential Splice Site 33 1120 2 20
Genomic Location:
Chromosome 13 (position 25735269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTAGCTTAAATGTTTTGATCCTAAGTGACTCATATCCATCTTTCTTTC[A/G]GCAACCGACTTGTTGCTAGCATGGAACCCTGTCTGTCTGGGCCTTGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Essential Splice Site 296 1126 8 20
ENSDART00000140634 Essential Splice Site 290 1120 8 20
Genomic Location:
Chromosome 13 (position 25745261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTCATCATGTTATCAGAGAAGTAACATCATCATGCATTTCCCACTGC[A/G]GGAATGCGCTACAAGAGGAGGGGGGTTGATACAGACGGACATGTGGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Nonsense 308 1126 8 20
ENSDART00000140634 Nonsense 302 1120 8 20
Genomic Location:
Chromosome 13 (position 25745298)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMTTTCCCACTGCAGGAATGCGCTACAAGAGGAGGGGGGTTGATACAGAC[G/T]GAYATRTGGCCAACTATGTAGAGACAGAGCAGTTAATCCACGTACACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Nonsense 555 1126 14 20
ENSDART00000140634 Nonsense 549 1120 14 20
Genomic Location:
Chromosome 13 (position 25749650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTAGCRGGGGTGAWGAAGGATGGTGTGAATTCAGCTAACCGTTACTA[T/A]CTGAACCGCTTCAGGGACGCCTAYCGACAGGCCGTCATYGGTGAGCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Essential Splice Site 635 1126 16 20
ENSDART00000140634 Essential Splice Site 629 1120 16 20
Genomic Location:
Chromosome 13 (position 25753258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTAAGGATTTTGACCTTTGAATATGCTGTTTTTCTCTCCATCTTTTTA[G/A]TCTTATAGATGCTACTCACAAAGATGTCGACGTTCTTCTGCTGCTCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087604 Essential Splice Site 727 1126 19 20
ENSDART00000140634 Essential Splice Site 721 1120 19 20
Genomic Location:
Chromosome 13 (position 25753885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAATAATTGATTCTTTCCTCTCCACTTGTTGGATTGTTTCCATTTCA[G/A]ACACACTCCAGTGCATTGCTGAAATGCTTCGAATTACAAAGCAAGCTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mjzkyuoe