col6a2

Ensembl ID:
ENSDARG00000061436
ZFIN ID:
ZDB-GENE-070501-7
Description:
Col6a2 protein [Source:UniProtKB/TrEMBL;Acc:A3KNX1]
Human Orthologue:
COL6A2
Human Description:
collagen, type VI, alpha 2 [Source:HGNC Symbol;Acc:2212]
Mouse Orthologue:
Col6a2
Mouse Description:
collagen, type VI, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15560 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087597 Nonsense 188 1015 2 27
ENSDART00000103187 Nonsense 188 310 3 9
ENSDART00000129629 Nonsense 188 303 3 8
Genomic Location:
Chromosome 11 (position 34786523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACGMGATGAAAATATTAGGATCTTCGCTGTGGCATCGTCCAGGAATT[T/A]GGAGGAGACGGGACTCAGGGAGATWGCAAACTCACCCGCTGGAGTTTACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wjzm9g5u