sec23ip

Ensembl ID:
ENSDARG00000061413
ZFIN ID:
ZDB-GENE-030131-5259
Description:
SEC23-interacting protein [Source:RefSeq peptide;Acc:NP_001070847]
Human Orthologue:
SEC23IP
Human Description:
SEC23 interacting protein [Source:HGNC Symbol;Acc:17018]
Mouse Orthologue:
Sec23ip
Mouse Description:
Sec23 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2450915]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15118 Essential Splice Site Available for shipment Available now
sa13215 Essential Splice Site Available for shipment Available now
sa42209 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22306 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 45 977 2 18
Genomic Location (Zv9):
Chromosome 13 (position 25775602)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25421262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGTATTGATATTAAAAATGATGCTAGATTTTTGTTTTTCTCTGTGC[A/T]GAAGATGCCRGTGAAGTYGGAGAAGAAGACAGCTTTCTTGGTCWGACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 378 977 5 18
Genomic Location (Zv9):
Chromosome 13 (position 25778475)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25424135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTGGAGTTYCCATCKGGTGAGACCATCGTGATGCACAATCCAAAGG[T/C]ACAACACTATCAGATTGATGGKAAACTATGGAAGCTTAGTTCASTCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 449 977 7 18
Genomic Location (Zv9):
Chromosome 13 (position 25779412)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25425072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATTGGTCCTGTCTGTGATCTGCGGTTTAGGAGTATGGTGGAGTGCGG[T/C]ATGTTACACTAAGTTACTCTCCAGATCAAATACAGTTTTTAAGACATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087553 Essential Splice Site 834 977 15 18
Genomic Location (Zv9):
Chromosome 13 (position 25787397)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25433057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCGGTTTTGGTCCCTCATCATAAAGGGAGGAAAAGGCTTCATCTCGG[T/G]AATGTATTAGACCATTTCTGTGCATTTTTTGAATGATCTTTCTCATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link