bivm

Ensembl ID:
ENSDARG00000061409
ZFIN ID:
ZDB-GENE-010822-3
Human Orthologue:
BIVM
Human Description:
basic, immunoglobulin-like variable motif containing [Source:HGNC Symbol;Acc:16034]
Mouse Orthologue:
Bivm
Mouse Description:
basic, immunoglobulin-like variable motif containing Gene [Source:MGI Symbol;Acc:MGI:2179809]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16027 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087563 Nonsense 271 506 5 9
ENSDART00000132456 Splice Site None 502 None 10
Genomic Location:
Chromosome 6 (position 29012930)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTCATCCCAAACTGTNNAGTGTACATGATCTATTTTTATTTTTGTTAT[C/T]GATGCAGATGGTTCAGACAAATCAATGATAATTTTCGTGTTCGGGGTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ds1pi6on