csgalnact2

Ensembl ID:
ENSDARG00000061400
ZFIN ID:
ZDB-GENE-030131-5186
Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 2 [Source:RefSeq peptide;Acc:NP_001119869]
Human Orthologue:
CSGALNACT2
Human Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 2 [Source:HGNC Symbol;Acc:24292]
Mouse Orthologue:
Csgalnact2
Mouse Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1926002]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16668 Nonsense Available for shipment Available now
sa10705 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087533 Nonsense 187 540 1 7
Genomic Location:
Chromosome 13 (position 25804634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAGGAAGGACCGGAGGGATGAGCTGGTKGAGGTGATCGAAGCTGGTT[T/A]GGATATTAKTAATAACCCTGAGGAAGACGATGGACAGGAKGACAACATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087533 Essential Splice Site 416 540 5 7
Genomic Location:
Chromosome 13 (position 25797195)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTTTATGGAAATCTGGAGTTTCCRCCACCCATTGAGAGTCAGCTGG[T/G]ATGTAATCATTATTTTTGTTGTTAGCTGAATTTGTAGCCTTSTAGTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/demaxb1q