si:ch211-272f3.4

Ensembl ID:
ENSDARG00000061397
ZFIN ID:
ZDB-GENE-041111-262
Description:
Novel protein similar to vertebrate thyroid hormone receptor interactor 12 (TRIP12) [Source:UniProtK
Human Orthologue:
TRIP12
Human Description:
thyroid hormone receptor interactor 12 [Source:HGNC Symbol;Acc:12306]
Mouse Orthologue:
Trip12
Mouse Description:
thyroid hormone receptor interactor 12 Gene [Source:MGI Symbol;Acc:MGI:1309481]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23366 Essential Splice Site Available for shipment Available now
sa9891 Nonsense Available for shipment Available now
sa9786 Nonsense Available for shipment Available now
sa10603 Nonsense Available for shipment Available now
sa13854 Nonsense Available for shipment Available now
sa8943 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17600 Essential Splice Site Available for shipment Available now
sa954 Nonsense F2 line generated During 2017
sa29080 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Essential Splice Site 719 2095 13 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Essential Splice Site 677 2026 13 41
Genomic Location (Zv9):
Chromosome 18 (position 39614846)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41284343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTTGTCTCTGTTTTGCTAGGCTGGTGGACAACTTTCAGCATGAAGAG[G/A]TGAGAAGTATTGCTAAGCACAAATAGCTAATTATGCAAACCTTAAGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Nonsense 722 2095 14 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Nonsense 680 2026 14 41
Genomic Location (Zv9):
Chromosome 18 (position 39616927)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41286424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTGTGTGTCNNNNTGTCTGTCTGTCTGTCTGTCACAGAACCTGT[T/A]ACAGCAGGTGGCGTCACGGGACCTTCTGACCAACATTCAACAACTGCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Nonsense 1101 2095 20 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Nonsense 1032 2026 20 41
Genomic Location (Zv9):
Chromosome 18 (position 39623221)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41292718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCCAAGTTTCCAGCACAGCATGGACGACKCGCTGGACCTCAGTCCA[C/T]AGGGGTATAAAACCACTCTGACATACACAGTTATCGATCTAGAGTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Nonsense 1339 2095 25 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Nonsense 1270 2026 25 41
Genomic Location (Zv9):
Chromosome 18 (position 39627799)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41297296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGCTTGCATTGGTGCACAAGATGAACAACTGCCTTAGTCAGATGGAA[C/T]AATTTCCTRTTAAAGTGCATGATTTCCCCAGTGGAAATGGCAACGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13854
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Nonsense 1372 2095 26 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Nonsense 1303 2026 26 41
Genomic Location (Zv9):
Chromosome 18 (position 39629730)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41299227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGGGTTCGCAGGCCCTGAAGTTCTTCAACACCCATCAGCTGAAATGC[C/T]AGCTGCAGAGACACCCAGACTGCACCAATGTCAAGCAGTGGAAGGGCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Essential Splice Site 1434 2095 28 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Essential Splice Site 1365 2026 28 41
Genomic Location (Zv9):
Chromosome 18 (position 39632050)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41301547
KASP Assay ID:
2261-2526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTCTTCCTCAACATTAAAACTSTGGACCTCTAACCATTTTYCCAAA[G/A]GCTGCCCAGTTCCTGAATTCTGGGAGTGTACGACACAGGCTGCAGTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Essential Splice Site 1500 2095 28 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Essential Splice Site 1431 2026 28 41
Genomic Location (Zv9):
Chromosome 18 (position 39632252)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41301749
KASP Assay ID:
2261-2527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAACCCTCTGGGACGTGCWGGCATCTGGACCAAAACACACACTGTATGG[T/A]ACGCAATTTACTAGCCTTTCACTCTTCAGAAGCGAAGAGCTWTTTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa954
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Nonsense 1535 2095 29 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Nonsense 1466 2026 29 41
Genomic Location (Zv9):
Chromosome 18 (position 39634270)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41303767
KASP Assay ID:
554-0859.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGGGTCGAGCACAGACGGCACCCACTAAAACCTCCCCTCGAAATGCC[A/T]AGAAACAGGACGAACTGTGGCATGGTATGGAGATATCNNNNNNNATTTTTAACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087566 Essential Splice Site 1593 2095 30 41
ENSDART00000138552   None 32 None 3
ENSDART00000145863 Essential Splice Site 1524 2026 30 41
Genomic Location (Zv9):
Chromosome 18 (position 39634540)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 41304037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGAGGGTCCTGCACTCCATCAGTAGATACTGGTTCTACCTGTACGATG[T/C]AAGTAAACCATGCTAGAGGATACAATTTAACTGTGTGAATCTCATGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link