baz1b

Ensembl ID:
ENSDARG00000061394
ZFIN ID:
ZDB-GENE-010328-16
Description:
Tyrosine-protein kinase BAZ1B [Source:UniProtKB/Swiss-Prot;Acc:A2BIL7]
Human Orthologue:
BAZ1B
Human Description:
bromodomain adjacent to zinc finger domain, 1B [Source:HGNC Symbol;Acc:961]
Mouse Orthologue:
Baz1b
Mouse Description:
bromodomain adjacent to zinc finger domain, 1B Gene [Source:MGI Symbol;Acc:MGI:1353499]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10488 Nonsense Available for shipment Available now
sa16558 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087480 Nonsense 861 1536 7 19
ENSDART00000128582 Nonsense 861 1802 7 18
ENSDART00000143452 Nonsense 861 1552 7 18
Genomic Location:
Chromosome 18 (position 39915328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGACGCTTGATGTCCATTCAGGCTAAGAAAGAAAAAGAAGAGCAGGAA[C/T]GACTRAATAAAGGTGAGAGARAATTATTTGCTTCGTTATTTATTTTTRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087480 Essential Splice Site 1356 1536 16 19
ENSDART00000128582 Essential Splice Site 1356 1802 16 18
ENSDART00000143452 Essential Splice Site 1356 1552 16 18
Genomic Location:
Chromosome 18 (position 39928500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTAAATCRCGAGCTGCACCAAGCAGYCCTGTTGACATCKATGAACTGG[T/C]GAGTGAAGCGAGGTGTGCAGAACTGAACTGTATGTACTACATYAGGATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Protein C levels: Genome-wide association study identifies novel loci for plasma levels of protein C: the ARIC study. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cih0wqeb