grhl1

Ensembl ID:
ENSDARG00000061391
ZFIN ID:
ZDB-GENE-030131-3665
Human Orthologue:
GRHL1
Human Description:
grainyhead-like 1 (Drosophila) [Source:HGNC Symbol;Acc:17923]
Mouse Orthologue:
Grhl1
Mouse Description:
grainyhead-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2182540]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14528 Essential Splice Site Available for shipment Available now
sa6488 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087454 Essential Splice Site 70 613 3 16
Genomic Location:
Chromosome 17 (position 32628358)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATRCTATTGGATGTGGTCAGACTTACACAGAGTTTGTTTGCTTTCCCC[A/T]GGTGCCACGGGACAAGAGAACAATATCCCAGCAAAAGACTGACGTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087454 Essential Splice Site 361 613 9 16
Genomic Location:
Chromosome 17 (position 32614447)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATTAAATAACTTGAACACTTCTTTCTCTCTCTCCCTCTTTCCTCCTC[A/T]GATCTTCATCTCRGTGAACTGCCTGAGCACAGACTTCTCGTCTCAGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1sidp60z