cmya5

Ensembl ID:
ENSDARG00000061379
ZFIN ID:
ZDB-GENE-070630-1
Description:
cardiomyopathy associated 5 [Source:RefSeq peptide;Acc:NP_001073454]
Human Orthologue:
CMYA5
Human Description:
cardiomyopathy associated 5 [Source:HGNC Symbol;Acc:14305]
Mouse Orthologue:
Cmya5
Mouse Description:
cardiomyopathy associated 5 Gene [Source:MGI Symbol;Acc:MGI:1923719]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13895 Nonsense Available for shipment Available now
sa25311 Nonsense Mutation detected in F1 DNA During 2016
sa33714 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087467 Nonsense 536 1759 2 13
Genomic Location (Zv9):
Chromosome 5 (position 53714801)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51207173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTGAGTCCACAGGGTGTTGTTCAAATGGACACTGTGGTCCGGAAATT[C/T]AACCAAAGGTGGAAGTAATCMTTAAAGAAAAAGTCATATCGGATGACTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087467 Nonsense 1185 1759 2 13
Genomic Location (Zv9):
Chromosome 5 (position 53716749)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51209121
KASP Assay ID:
554-7718.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTGGAGATGGGCTTTGAATTTGTTGAGGATTTAGACAGTGCCCAGT[T/A]GGCGGATGAACTTGAAGAGGATGTAGAAATTCAACCAATGGATGCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087467 Nonsense 1618 1759 12 13
Genomic Location (Zv9):
Chromosome 5 (position 53739406)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51231767
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATCTTGAGTTACAGCAAAAGCCTTTGTTTTACCATGTTCCCAGTTG[T/A]CCATCAGTTATGGGGGAGATTTTACAATCGAATGGGTATTACTACTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link