si:ch211-168p1.3

Ensembl ID:
ENSDARG00000061378
ZFIN ID:
ZDB-GENE-091204-279
Human Orthologue:
C17orf71
Human Description:
chromosome 17 open reading frame 71 [Source:HGNC Symbol;Acc:25551]
Mouse Orthologue:
1200011M11Rik
Mouse Description:
RIKEN cDNA 1200011M11 gene Gene [Source:MGI Symbol;Acc:MGI:1921383]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41701 Nonsense Mutation detected in F1 DNA During 2017
sa24882 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087477 Nonsense 477 916 1 4
Genomic Location (Zv9):
Chromosome 10 (position 36270503)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35303205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGGGTTGCTTTTCAACGCTACGCTTTACAGCTTCATGAGGATTGCTA[C/A]AAGTTCTGGAGTAACGGGCATCAGCTCTGTGAGGAGCGCAGCCTTACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087477 Nonsense 635 916 3 4
Genomic Location (Zv9):
Chromosome 10 (position 36265408)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35298110
KASP Assay ID:
554-7292.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAGTCTCGCTCTCAGCTTGGGCCAGTCAACGGACAGCCTTGGAACATA[C/A]GCTGACGGAGCAGAAGGACAGGAGAAGAGACCAAGCTTGGTGGACCGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link