sgpl1

Ensembl ID:
ENSDARG00000061375
ZFIN ID:
ZDB-GENE-070410-24
Description:
sphingosine-1-phosphate lyase 1 [Source:RefSeq peptide;Acc:NP_001082938]
Human Orthologue:
SGPL1
Human Description:
sphingosine-1-phosphate lyase 1 [Source:HGNC Symbol;Acc:10817]
Mouse Orthologue:
Sgpl1
Mouse Description:
sphingosine phosphate lyase 1 Gene [Source:MGI Symbol;Acc:MGI:1261415]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22308 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111567 Essential Splice Site 267 572 8 14
ENSDART00000147420 Essential Splice Site 289 306 8 9
Genomic Location (Zv9):
Chromosome 13 (position 25959179)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25604839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCATTCATGTACCGTTGGACAATAAGACCATGAAAGTTGATGTGAAGG[T/G]AATGCTGCGTTATTGAGTGAGCACAAATGGGTGCATTTTTAAACCCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link