cog7

Ensembl ID:
ENSDARG00000061372
ZFIN ID:
ZDB-GENE-061013-463
Description:
conserved oligomeric Golgi complex subunit 7 [Source:RefSeq peptide;Acc:NP_001070861]
Human Orthologue:
COG7
Human Description:
component of oligomeric golgi complex 7 [Source:HGNC Symbol;Acc:18622]
Mouse Orthologue:
Cog7
Mouse Description:
component of oligomeric golgi complex 7 Gene [Source:MGI Symbol;Acc:MGI:2685013]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44179 Nonsense Mutation detected in F1 DNA During 2017
sa31103 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087438 Nonsense 48 730 2 17
ENSDART00000087438 Nonsense 48 730 2 17
Genomic Location (Zv9):
Chromosome 24 (position 38733969)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37176684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGAGAGATATTGAGGCTCTAAAACAAGAGGCATCATTTCTGAAGGAT[C/T]AGATGATTCTGGTTAAAGAGGACATCAAGAAATTTGAGCAGGACACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087438 Nonsense 48 730 2 17
ENSDART00000087438 Nonsense 48 730 2 17
Genomic Location (Zv9):
Chromosome 24 (position 38733969)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37176684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGAGAGATATTGAGGCTCTAAAACAAGAGGCATCATTTCTGAAGGAT[C/T]AGATGATTCTGGTTAAAGAGGACATCAAGAAATTTGAGCAGGACACAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link