cdh18

Ensembl ID:
ENSDARG00000061371
ZFIN ID:
ZDB-GENE-060929-316
Description:
cadherin 18, type 2 [Source:RefSeq peptide;Acc:NP_001070203]
Human Orthologue:
CDH18
Human Description:
cadherin 18, type 2 [Source:HGNC Symbol;Acc:1757]
Mouse Orthologue:
Cdh18
Mouse Description:
cadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1344366]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32933 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32933
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025562   None 790 None 11
ENSDART00000099157 Nonsense 105 108 2 2
Genomic Location (Zv9):
Chromosome 2 (position 28973121)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29274756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTGTGCTTAAACCATGCAGGCGAGCTGAGCTGCTGGGTCTCGTGTG[G/A]TTTGTTAAGTGAACTGTTCCTTGAAAGAGCACAGTTTTAACCAGAGACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link