si:ch211-287b5.2

Ensembl ID:
ENSDARG00000061365
ZFIN ID:
ZDB-GENE-060503-135
Description:
Si:ch211-287b5.2 [Source:UniProtKB/TrEMBL;Acc:A4JYQ6]
Human Orthologue:
HEPACAM2
Human Description:
HEPACAM family member 2 [Source:HGNC Symbol;Acc:27364]
Mouse Orthologue:
Hepacam2
Mouse Description:
HEPACAM family member 2 Gene [Source:MGI Symbol;Acc:MGI:2141520]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7462 Missense Mutation detected in F1 DNA During 2017
sa43333 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087444 Missense 160 457 3 9
ENSDART00000137752 Missense 162 362 3 5
Genomic Location (Zv9):
Chromosome 19 (position 41324317)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40776855
KASP Assay ID:
554-4331.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCACTCCTGTTATCAGTAAAACCCCAGAATCTGAACTTGTTGAAGAY[C/T]GGGACAACGTAACGCTGACTTGTTCTGCTCWACAMGGGACGGAGATTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087444 Nonsense 305 457 4 9
ENSDART00000137752 Nonsense 307 362 4 5
Genomic Location (Zv9):
Chromosome 19 (position 41326242)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40778780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGTCATGACGGGGCCAAGGTTGGAGGTGAAGACGTACGAGTTGCCA[C/T]AGGGGAAGGAGTTCTTGTGCAGAGCTTTCAATAACGCCACGAAGAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link