abp1

Ensembl ID:
ENSDARG00000061355
ZFIN ID:
ZDB-GENE-061103-112
Description:
amiloride-sensitive amine oxidase [Source:RefSeq peptide;Acc:NP_001071066]
Human Orthologue:
ABP1
Human Description:
amiloride binding protein 1 (amine oxidase (copper-containing)) [Source:HGNC Symbol;Acc:80]
Mouse Orthologues:
1600015I10Rik, Abp1, Doxl2, Svs1
Mouse Descriptions:
amiloride binding protein 1 (amine oxidase, copper-containing) Gene [Source:MGI Symbol;Acc:MGI:19237
diamine oxidase-like protein 2 Gene [Source:MGI Symbol;Acc:MGI:3618290]
RIKEN cDNA 1600015I10 gene Gene [Source:MGI Symbol;Acc:MGI:1917011]
seminal vesicle secretory protein 1 Gene [Source:MGI Symbol;Acc:MGI:2682321]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087422 Nonsense 295 742 2 5
Genomic Location:
Chromosome 24 (position 41579935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACATGAACACACGGWCCAACATCCATGGAGCAAAGCTTGTTGAACCA[C/T]AAGGGCGCAGATTTCAGGTGGATGGGAATTTCRTRGAGTATGCYGGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eeg92pyp