tfpi2

Ensembl ID:
ENSDARG00000061351
ZFIN ID:
ZDB-GENE-060503-38
Description:
tissue factor pathway inhibitor 2 [Source:RefSeq peptide;Acc:NP_001035185]
Human Orthologue:
TFPI2
Human Description:
tissue factor pathway inhibitor 2 [Source:HGNC Symbol;Acc:11761]
Mouse Orthologue:
Tfpi2
Mouse Description:
tissue factor pathway inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:108543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4819 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087421 Nonsense 124 233 3 5
Genomic Location:
Chromosome 19 (position 41813855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAATATGACCTCCATGCAGTGTGAACCATTCAYTTATGGTGGCTGC[C/T]AAGGGAATGAGAAYAATTTTCGAAACCCAGAGGAATGCATAGAATATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/skbxkdox