ddx6

Ensembl ID:
ENSDARG00000061338
ZFIN ID:
ZDB-GENE-070912-83
Human Orthologue:
DDX6
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 [Source:HGNC Symbol;Acc:2747]
Mouse Orthologue:
Ddx6
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23370 Essential Splice Site Available for shipment Available now
sa36717 Nonsense Mutation detected in F1 DNA During 2017
sa16927 Nonsense Available for shipment Available now
sa17615 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087382 Essential Splice Site 89 485 2 12
Genomic Location (Zv9):
Chromosome 18 (position 42280411)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43885783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAATCTAAAGCTTCCTCCAAAAGATTTGCGAATGAAAACATCAG[T/C]AAGTCCCTCTGTAATTTTGTGTTTTTTATTTAATTTTATAAAGGCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087382 Nonsense 229 485 6 12
Genomic Location (Zv9):
Chromosome 18 (position 42277974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43883346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTATTCTATTTGTAGTGCACGTCGTCATCGCCACTCCAGGAAGAATTT[T/A]AGACCTCATCAAAAAGGGAGTGGCCAAAGTGGGTCAAGTGCAGATGATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087382 Nonsense 315 485 8 12
Genomic Location (Zv9):
Chromosome 18 (position 42275006)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43880378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATAAACCTGAWGGAGGAGCTGACCCTGAAGGGGGTTACTCAGTATTA[T/A]GCCTATGTGACTGAAAGGCAGAAAGTCCATTGCCTTAATACTCTATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17615
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087382 Nonsense 429 485 12 12
Genomic Location (Zv9):
Chromosome 18 (position 42272236)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 43877608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAGAAGAATCTGTGTAAATGATAATTGCCTTTTTGTCCTTCTCAGGC[C/T]GATTTGGACACTTGGGTCTTGCCATTAACTTGATCACTTAYGATGACCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link