si:ch211-194b7.3

Ensembl ID:
ENSDARG00000061335
ZFIN ID:
ZDB-GENE-030131-2360
Human Orthologue:
GALNT1
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1) [Sour
Mouse Orthologue:
Galnt1
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32092 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087368 Nonsense 78 557 2 11
ENSDART00000140673 Nonsense 78 557 4 13
Genomic Location (Zv9):
Chromosome 16 (position 29245409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27121183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGTGGTCATCGCTAAAGACCAGCAGGAGAAGATGAAGGAAATGTTT[A/T]AGATAAACCAGTTTAACCTGATGGCCAGCGAGATGATTGCGCTCAACCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link