cdon

Ensembl ID:
ENSDARG00000061328
ZFIN ID:
ZDB-GENE-021115-4
Description:
cell adhesion molecule-related/down-regulated by oncogenes [Source:RefSeq peptide;Acc:NP_001075097]
Human Orthologue:
CDON
Human Description:
Cdon homolog (mouse) [Source:HGNC Symbol;Acc:17104]
Mouse Orthologue:
Cdon
Mouse Description:
cell adhesion molecule-related/down-regulated by oncogenes Gene [Source:MGI Symbol;Acc:MGI:1926387]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10351 Essential Splice Site Available for shipment Available now
sa36720 Nonsense Mutation detected in F1 DNA During 2016
sa36719 Nonsense Mutation detected in F1 DNA During 2016
sa23371 Nonsense Available for shipment Available now
sa43164 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Essential Splice Site 24 1125 2 19
ENSDART00000110633 Essential Splice Site 24 348 2 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42505980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44111352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCMGCTGTGCTTTGTGTGTGCCATACTCTGCTCCTCAACTGCCCAA[G/A]TGAGTATCACAMTCAAAAAAAGTYATTGCAATTGAAACACTTACTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Nonsense 354 1125 7 19
ENSDART00000110633   None 348 None 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42502106)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44107478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGGCAATCCAACCCCCAACATCACATGGCTCCTTAACGCTGCCCCTT[T/A]ATCTTCTTCACCCCGCCTCAAAATCTCTGGCACCTCCCTTCTCATCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Nonsense 392 1125 7 19
ENSDART00000110633   None 348 None 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42501993)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44107365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCAGGGAATCTACCAGTGCATGTTTGATAATGGCATTAGCTCTGCA[C/T]AATCCACAGGAAGACTCAGTATCCAATCAGGTAAGATACCTAAAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Nonsense 634 1125 11 19
ENSDART00000110633   None 348 None 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42481879)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44087251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCAATGGTGGCTCTCCCATCACTGCATTTCGCGTGGAGTACAGAAAA[C/T]AGGGGCGTAATGGAGACTGGATCATTGCAGCTGATAACATCTCACCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Essential Splice Site 798 1125 14 19
ENSDART00000110633   None 348 None 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42472513)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44077885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGCGGCGAGAGCGAATACAGTAACGTCATGATCTGCGAGACCAAAG[G/A]TGAGAGTCTGAAGTACCGTCACAGGAATGCTATACTTAACATGCAGACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link