cdon

Ensembl ID:
ENSDARG00000061328
ZFIN ID:
ZDB-GENE-021115-4
Description:
cell adhesion molecule-related/down-regulated by oncogenes [Source:RefSeq peptide;Acc:NP_001075097]
Human Orthologue:
CDON
Human Description:
Cdon homolog (mouse) [Source:HGNC Symbol;Acc:17104]
Mouse Orthologue:
Cdon
Mouse Description:
cell adhesion molecule-related/down-regulated by oncogenes Gene [Source:MGI Symbol;Acc:MGI:1926387]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10351 Essential Splice Site Available for shipment Available now
sa23371 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Essential Splice Site 24 1125 2 19
ENSDART00000110633 Essential Splice Site 24 348 2 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 42505980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTCMGCTGTGCTTTGTGTGTGCCATACTCTGCTCCTCAACTGCCCAA[G/A]TGAGTATCACAMTCAAAAAAAGTYATTGCAATTGAAACACTTACTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087339 Nonsense 634 1125 11 19
ENSDART00000110633 None None 348 None 8

The following transcripts of ENSDARG00000061328 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 42481879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCCAATGGTGGCTCTCCCATCACTGCATTTCGCGTGGAGTACAGAAAA[C/T]AGGGGCGTAATGGAGACTGGATCATTGCAGCTGATAACATCTCACCGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xcnkh707