si:ch211-199o1.5

Ensembl ID:
ENSDARG00000061314
ZFIN ID:
ZDB-GENE-060503-19
Description:
neugrin [Source:RefSeq peptide;Acc:NP_001038718]
Human Orthologues:
AC004840.2, NGRN
Human Descriptions:
neugrin, neurite outgrowth associated [Source:HGNC Symbol;Acc:18077]
Similar to mesenchymal stem cell protein DSC92; neurite outgrowth associated protein [Source:UniProt
Mouse Orthologue:
Ngrn
Mouse Description:
neugrin, neurite outgrowth associated Gene [Source:MGI Symbol;Acc:MGI:1933212]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34401 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087338 Nonsense 170 289 4 4
ENSDART00000123300 Nonsense 170 289 4 4

The following transcripts of ENSDARG00000061314 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 25892749)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25020667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCTCCCCCAGCAGTGGACCACAGTATCTCAAAGACGGCAAAGCTGAA[C/T]AATCCAGACTTCAGAAGAGCTTGACTCCATCAGTACTGCTCCCCTCTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link