pds5b

Ensembl ID:
ENSDARG00000061312
ZFIN ID:
ZDB-GENE-091217-2
Human Orthologue:
PDS5B
Human Description:
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:20418]
Mouse Orthologue:
Pds5b
Mouse Description:
PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35942 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35943 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087246 Essential Splice Site 133 1415 3 33
Genomic Location (Zv9):
Chromosome 15 (position 32076519)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33940028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGACACAAAGAGTGCTCAGTTTAATCGATATTTTTATCTACTGGAG[G/A]TATGGCACCCAACTAATAGACACCGTAATAAGGTCTAATGGTTTAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087246 Nonsense 171 1415 5 33
Genomic Location (Zv9):
Chromosome 15 (position 32079584)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33936963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTTACAATGTTTTTTCTCTCTCGTTTTCTTTTAGCAATGGACACAAT[C/T]AGAAAGTTCACATGCATATGGTGGATCTCATGAGCTCAATTGTGTGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link