crebbpa

Ensembl ID:
ENSDARG00000061308
ZFIN ID:
ZDB-GENE-050208-439
Description:
CREB binding protein [Source:RefSeq peptide;Acc:NP_001082924]
Human Orthologue:
CREBBP
Human Description:
CREB binding protein [Source:HGNC Symbol;Acc:2348]
Mouse Orthologue:
Crebbp
Mouse Description:
CREB binding protein Gene [Source:MGI Symbol;Acc:MGI:1098280]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9163 Nonsense Mutation detected in F1 DNA During 2014
sa25181 Nonsense Mutation detected in F1 DNA During 2014
sa14981 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087250 Nonsense 253 2349 3 31
ENSDART00000148002 Nonsense 253 2312 3 31
Genomic Location:
Chromosome 22 (position 27373185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGGCAGGTGGCAACAGTCCATTTGGGCAGTACCAGGCTGGAGGTCAA[C/T]AACTGGGCACGAACGCACAGAATAAAGGCGCCCTTCCCAACAGCCTCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087250 Nonsense 1252 2349 24 31
ENSDART00000148002 Nonsense 1215 2312 24 31
Genomic Location:
Chromosome 22 (position 27406790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGTACTTGAAGAGGCAGAACCATCCGGAAGCTGGAGAGGTGTTTGTA[C/T]GAGTAGTAGCCAGTTCAGACAAAACGGTGGAGGTCAAACCTGGCATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087250 Nonsense 1931 2349 31 31
ENSDART00000148002 Nonsense 1894 2312 31 31
Genomic Location:
Chromosome 22 (position 27410474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTRTTGGGCCACGYGGRCAGCAGGTCATGCAGCMCATGCCGCAAGGA[C/T]AGTGGCCTGGAGGCGCTCAGCCTAGTATGCCAGCAGCYCAGCAGCAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dn6adi1p