ppp1r9a

Ensembl ID:
ENSDARG00000061304
ZFIN ID:
ZDB-GENE-060503-660
Description:
Novel protein similar to vertebrate protein phosphatase 1, regulatory (Inhibitor) subunit 9A (PPP1R9
Human Orthologue:
PPP1R9A
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 9A [Source:HGNC Symbol;Acc:14946]
Mouse Orthologue:
Ppp1r9a
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14155 Nonsense Available for shipment Available now
sa13639 Nonsense Available for shipment Available now
sa16010 Nonsense Available for shipment Available now
sa13337 Essential Splice Site Available for shipment Available now
sa23582 Nonsense Available for shipment Available now
sa15395 Nonsense Available for shipment Available now
sa16039 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Nonsense 345 1068 1 18
ENSDART00000138687 Nonsense 345 794 1 10
ENSDART00000138752   None 118 None 2
ENSDART00000087295 Nonsense 345 1068 1 18
ENSDART00000138687 Nonsense 345 794 1 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42041898)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41494152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAYACGGACGGTCMTGTGAAAGAGGAGTCTAGGCGGATTACAGAGGAT[C/T]AGATTGAAGAAACMAATGAGGAATACTGTGGTAATGAGAGAGTTRTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Nonsense 345 1068 1 18
ENSDART00000138687 Nonsense 345 794 1 10
ENSDART00000138752   None 118 None 2
ENSDART00000087295 Nonsense 345 1068 1 18
ENSDART00000138687 Nonsense 345 794 1 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42041898)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41494152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAYACGGACGGTCMTGTGAAAGAGGAGTCTAGGCGGATTACAGAGGAT[C/T]AGATTGAAGAAACMAATGAGGAATACTGTGGTAATGAGAGAGTTRTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16010
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Nonsense 583 1068 5 18
ENSDART00000138687 Nonsense 583 794 5 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42087931)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41540185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGGARAAACGTCAGAGAGAGATGATGGAGCAGCAATACGCACAAKA[T/A]GACGCGGATGACGATGAGGTGAGCGTTACGGACCTGTCTGAGCATGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Essential Splice Site 767 1068 9 18
ENSDART00000138687 Essential Splice Site 767 794 9 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42104802)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41557056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCAGAAAAGGCTCATTTGGCTGAAATCCAGAGTCTTCAAGTGAGGG[T/A]AATTATCAGCAYACACACGTCAGTGCACTTCAATRCATTTCTGGGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Nonsense 773 1068 10 18
ENSDART00000138687 Nonsense 773 794 10 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42107626)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41559880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTATTATTAAAAAAAACTTTCTATGTTTTAGATTGCTACTCTGGAGT[C/A]AGAGCTGATGCAACTGATGAAGCAAAATGGCATCCAAGTAAACAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Nonsense 853 1068 12 18
ENSDART00000138687   None 794 None 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42110609)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41562863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTCCTCCAGAGCATCTGATRCCACAGAGGCCACAATCAGGCACCTG[C/T]AGCCTCATCCGGGACCTGATAATGAGGRTAAACGCTCCAAACCATTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087295 Essential Splice Site 861 1068 12 18
ENSDART00000138687   None 794 None 10
ENSDART00000138752   None 118 None 2
Genomic Location (Zv9):
Chromosome 19 (position 42110637)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41562891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGCCACAATCAGGCACCTGYAGCCTCATCCGGGACCTGATAATGAGG[G/A]TAAACGCTCCAAACCATTAATACCTGATWAGGGCTCAATTACAGGCCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link