oca2

Ensembl ID:
ENSDARG00000061303
ZFIN ID:
ZDB-GENE-070718-4
Human Orthologue:
OCA2
Human Description:
oculocutaneous albinism II [Source:HGNC Symbol;Acc:8101]
Mouse Orthologue:
Oca2
Mouse Description:
oculocutaneous albinism II Gene [Source:MGI Symbol;Acc:MGI:97454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9009 Nonsense Mutation detected in F1 DNA During 2014
sa11052 Nonsense Available for shipment Available now
sa20754 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Nonsense 159 807 3 22
Genomic Location:
Chromosome 6 (position 37831991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTCACCAGTCTCTCACWCATTACATCCCCGGAGAAGAGTGAAAATTA[C/A]TTCAAACTCTCTTTTCCCATCAGGTATGAAATACTGTTTAAAAGATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Nonsense 185 807 4 22
Genomic Location:
Chromosome 6 (position 37835451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTAGGGATGACAAGACTCATCACCATCTTCGTTATTGTYGTTCTGTG[T/A]TCAGTAAGTTCTCCATWAATCAGACCTAATCAACAAAGTGCTTTAGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Essential Splice Site 186 807 4 22
Genomic Location:
Chromosome 6 (position 37835456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGATGACAAGACTCATCACCATCTTCGTTATTGTCGTTCTGTGTTCAG[T/G]AAGTTCTCCATAAATCAGACCTAATCAACAAAGTGCTTTAGCGTGCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5ino3cs9