oca2

Ensembl ID:
ENSDARG00000061303
ZFIN ID:
ZDB-GENE-070718-4
Human Orthologue:
OCA2
Human Description:
oculocutaneous albinism II [Source:HGNC Symbol;Acc:8101]
Mouse Orthologue:
Oca2
Mouse Description:
oculocutaneous albinism II Gene [Source:MGI Symbol;Acc:MGI:97454]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9009 Nonsense Mutation detected in F1 DNA During 2016
sa11052 Nonsense Available for shipment Available now
sa20754 Essential Splice Site Available for shipment Available now
sa33907 Essential Splice Site Available for shipment Available now
sa33908 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Nonsense 159 807 3 22
Genomic Location (Zv9):
Chromosome 6 (position 37831991)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37903584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTCACCAGTCTCTCACWCATTACATCCCCGGAGAAGAGTGAAAATTA[C/A]TTCAAACTCTCTTTTCCCATCAGGTATGAAATACTGTTTAAAAGATTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Nonsense 185 807 4 22
Genomic Location (Zv9):
Chromosome 6 (position 37835451)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37907051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCTAGGGATGACAAGACTCATCACCATCTTCGTTATTGTYGTTCTGTG[T/A]TCAGTAAGTTCTCCATWAATCAGACCTAATCAACAAAGTGCTTTAGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Essential Splice Site 186 807 4 22
Genomic Location (Zv9):
Chromosome 6 (position 37835456)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37907056
KASP Assay ID:
2259-7809.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGATGACAAGACTCATCACCATCTTCGTTATTGTCGTTCTGTGTTCAG[T/G]AAGTTCTCCATAAATCAGACCTAATCAACAAAGTGCTTTAGCGTGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Essential Splice Site 690 807 19 22
Genomic Location (Zv9):
Chromosome 6 (position 37924433)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 37996033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTGTTTTTTGGTCTATGGCTTGATTTTTCTCTGTGGTGTGTTTTTAA[G/A]GCTCTCGCTCAGCTGCAGCTCATCGACTACATTGGGGAGCAGACTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087311 Essential Splice Site 745 807 21 22
Genomic Location (Zv9):
Chromosome 6 (position 37940963)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 38012563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGTTCTGAGTTCCTGTGCCTAATGGAATTATATATTTTTCCTCCAC[A/T]GATTCCAGTACTCATAAATCTCAGTCAAGATGCCGATGTCAACTTGCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link