arhgap5

Ensembl ID:
ENSDARG00000061294
ZFIN ID:
ZDB-GENE-081014-1
Human Orthologue:
ARHGAP5
Human Description:
Rho GTPase activating protein 5 [Source:HGNC Symbol;Acc:675]
Mouse Orthologue:
Arhgap5
Mouse Description:
Rho GTPase activating protein 5 Gene [Source:MGI Symbol;Acc:MGI:1332637]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42964 Nonsense Mutation detected in F1 DNA During 2016
sa36459 Nonsense Mutation detected in F1 DNA During 2016
sa6487 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086696 Nonsense 338 1503 1 6
Genomic Location (Zv9):
Chromosome 17 (position 31803291)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31727218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATAGAGCAGCTGAGACAAGAGCATATCAAGAGGCGGCGTGAGGATTA[T/G]CTTACCAGCCTGCCAAAAATTTTTAATAAGTTGCTTAACAACCTGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086696 Nonsense 414 1503 1 6
Genomic Location (Zv9):
Chromosome 17 (position 31803519)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31727446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGAGTGCCCTTCGATATCCTCCAAACCATGCAAGGAGAGAGGATTTA[T/A]CAAAACCATGTCCAGCATTTGATATCTGAGAAGAGGCGGCTGGAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086696 Essential Splice Site 1320 1503 3 6
Genomic Location (Zv9):
Chromosome 17 (position 31843314)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 31767241
KASP Assay ID:
554-4036.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGAAACAAGACGGATCAAGACAATATTCAGAAACAATTCGACCAGGG[T/C]ACGTACTGATTTATAACCGGGCTCTGTGGGAAATTAAGCTTAATTTGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link