kcnc4

Ensembl ID:
ENSDARG00000061288
ZFIN ID:
ZDB-GENE-060503-773
Description:
potassium voltage-gated channel subfamily C member 4 [Source:RefSeq peptide;Acc:NP_001182125]
Human Orthologues:
KCNC1, KCNC2, KCNC3, KCNC4
Human Descriptions:
potassium voltage-gated channel, Shaw-related subfamily, member 1 [Source:HGNC Symbol;Acc:6233]
potassium voltage-gated channel, Shaw-related subfamily, member 2 [Source:HGNC Symbol;Acc:6234]
potassium voltage-gated channel, Shaw-related subfamily, member 3 [Source:HGNC Symbol;Acc:6235]
potassium voltage-gated channel, Shaw-related subfamily, member 4 [Source:HGNC Symbol;Acc:6236]
Mouse Orthologues:
Kcnc1, Kcnc2, Kcnc3, Kcnc4
Mouse Descriptions:
potassium voltage gated channel, Shaw-related subfamily, member 1 Gene [Source:MGI Symbol;Acc:MGI:96
potassium voltage gated channel, Shaw-related subfamily, member 2 Gene [Source:MGI Symbol;Acc:MGI:96
potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:96
potassium voltage gated channel, Shaw-related subfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:96

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7136 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087293 Nonsense 481 603 2 4
ENSDART00000146805 Nonsense 481 581 2 3
Genomic Location (Zv9):
Chromosome 8 (position 25792581)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24920499
KASP Assay ID:
554-5181.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGCCCAAGAAGAAGAAGAAGCACAACCCAAACCCAGGTATGGTGT[T/A]GGACTCTGGCTCATTTGGGAAGTCTGAAAGCAACTCGCCACGGAACAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link