plxna1

Ensembl ID:
ENSDARG00000061275
ZFIN ID:
ZDB-GENE-061007-1
Description:
plexin A1 [Source:RefSeq peptide;Acc:NP_001103480]
Human Orthologue:
PLXNA1
Human Description:
plexin A1 [Source:HGNC Symbol;Acc:9099]
Mouse Orthologue:
Plxna1
Mouse Description:
plexin A1 Gene [Source:MGI Symbol;Acc:MGI:107685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33785 Nonsense Mutation detected in F1 DNA During 2017
sa20605 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086317 Nonsense 429 677 9 14
Genomic Location (Zv9):
Chromosome 6 (position 1259729)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 794206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTCCTGACAGCCTGCGCTCTCGGACCCCCATGATCACCCCGGACCTG[G/T]AGAGCGGAACCAAGCTCTGGCATCTGGTGAAGAACCACGACCACACGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086317 Nonsense 559 677 11 14
Genomic Location (Zv9):
Chromosome 6 (position 1264694)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 790540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACATTCATAAGAACAGCATTACCGACGCGTGTCTGTCCGTGGTGGCG[C/T]AGACCTTCATGGACTCCTGCTCCACATCTGAACACAAGCTGGGCAAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link