lss

Ensembl ID:
ENSDARG00000061274
ZFIN ID:
ZDB-GENE-050119-7
Description:
lanosterol synthase [Source:RefSeq peptide;Acc:NP_001077036]
Human Orthologue:
LSS
Human Description:
lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) [Source:HGNC Symbol;Acc:6708]
Mouse Orthologue:
Lss
Mouse Description:
lanosterol synthase Gene [Source:MGI Symbol;Acc:MGI:1336155]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7203 Nonsense Mutation detected in F1 DNA During 2014
sa8442 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8616 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Nonsense 284 735 8 22
Genomic Location:
Chromosome 9 (position 39540745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTACTCCACTATTGACTGGCCAGCTCAGAGGAACAACGTTGCARCCTG[T/A]GATTTATACACACCRCACAGCAACTTGCTTACTTTCGCTTATTGTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Essential Splice Site 490 735 15 22
ENSDART00000087241 Essential Splice Site 490 735 15 22
Genomic Location:
Chromosome 9 (position 39543451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTSAAAGAGAACATTCCCAAGGAAAGGCTTTTTGATGCTGTCAATGTGG[T/A]AATAACCTTACTTGTGTATATACTGTCTGTTTYGAATGCTGAMATAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087241 Essential Splice Site 490 735 15 22
ENSDART00000087241 Essential Splice Site 490 735 15 22
Genomic Location:
Chromosome 9 (position 39543451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTSAAAGAGAACATTCCCAAGGAAAGGCTTTTTGATGCTGTCAATGTGG[T/A]AATAACCTTACTTGTGTATATACTGTCTGTTTYGAATGCTGAMATAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ifsz7om2