LOC570630

Ensembl ID:
ENSDARG00000061268
Human Orthologue:
EIF2C2
Human Description:
eukaryotic translation initiation factor 2C, 2 [Source:HGNC Symbol;Acc:3263]
Mouse Orthologue:
Eif2c2
Mouse Description:
eukaryotic translation initiation factor 2C, 2 Gene [Source:MGI Symbol;Acc:MGI:2446632]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23583 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23584 Essential Splice Site Mutation detected in F1 DNA During 2014
sa196 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa23583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087187 Essential Splice Site 86 873 3 20
Genomic Location:
Chromosome 19 (position 42456878)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATGAAATAGACATCAAGCCTGAGAAATGCCCACGGAGAGTTAACCGG[T/A]AAAATCTTTTGACTCAACCTAAAATTTCCTACTAATTGTTTGGGTGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23584
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087187 Essential Splice Site 438 873 12 20
Genomic Location:
Chromosome 19 (position 42464350)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATTTGGTTGAATCCCTGTCTAATTTGGTCATGTCTTTGGCTGTTTC[A/G]GAACAAAGCAATAGCAACCCCAGTCCAGGGCGTGTGGGACATGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa196
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087187 Nonsense 530 873 13 20
Genomic Location:
Chromosome 19 (position 42465556)
KASP Assay ID:
554-0108.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTGTGGAGCCCATGTTCAAACACCTCAAGTACACTTATCAAGGGTTA[C/T]AGTTGGTGGTGGTCATCTTACCCGGCAAGACTCCTGTTTATGGTAATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b0lkvlno