si:ch211-9a18.4

Ensembl ID:
ENSDARG00000061267
ZFIN ID:
ZDB-GENE-091204-339
Human Orthologue:
CIDEA
Human Description:
cell death-inducing DFFA-like effector a [Source:HGNC Symbol;Acc:1976]
Mouse Orthologue:
Cidea
Mouse Description:
cell death-inducing DNA fragmentation factor, alpha subunit-like effector A Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37807 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087201 Nonsense 203 214 6 7
ENSDART00000135494   None 147 None 3
Genomic Location (Zv9):
Chromosome 24 (position 3127711)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2951571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGGTCAGGTTCTGCTGTGTGCCTCCACATATGTGCTGCGGTATATC[G/T]GAGATGAGGAATGCTCAAGCTAAACGTCACATCAGCTGATGACAGATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link