si:dkey-101k6.3

Ensembl ID:
ENSDARG00000061265
ZFIN ID:
ZDB-GENE-081104-298
Description:
Novel protein similar to human and mouse leishmanolysin-like (Metallopeptidase M8 family) (LMLN) [So
Human Orthologue:
LMLN
Human Description:
leishmanolysin-like (metallopeptidase M8 family) [Source:HGNC Symbol;Acc:15991]
Mouse Orthologue:
Lmln
Mouse Description:
leishmanolysin-like (metallopeptidase M8 family) Gene [Source:MGI Symbol;Acc:MGI:2444736]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10369 Nonsense Available for shipment Available now
sa34710 Nonsense Mutation detected in F1 DNA During 2017
sa31738 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 52 664 2 17
ENSDART00000140331 Nonsense 8 619 1 16
Genomic Location (Zv9):
Chromosome 9 (position 39555563)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38693459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATAGCAATATCTGCTGTTACTCTTTTAGGTGATTCATAAGGTCTTTT[T/A]GAAGCCAGATAGACTGACCAAAAGAAGCACTGACCAGCAGTTAAACATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 108 664 4 17
ENSDART00000140331 Nonsense 64 619 3 16
Genomic Location (Zv9):
Chromosome 9 (position 39555945)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38693841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCCCACAGGCTATTGATTATCTTCAGAAGGCTTTCAGGGTTCGCAGA[C/T]AGTCGGGTCCGATATTACTTAGCAGGTAATTCTCTTCTGAGCGACTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087229 Nonsense 285 664 9 17
ENSDART00000140331 Nonsense 241 619 8 16
Genomic Location (Zv9):
Chromosome 9 (position 39560017)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38697913
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTCTATCATTTAATTCATTACTTTCTGTCTTTCTCTCAGTTTAGGGT[T/A]ATATCAGTGGAGTGATAAAGTCATTAAAAGAGCAACTCGACTGTGGGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link