NP_001165868.1

Ensembl ID:
ENSDARG00000061248
Description:
xylosyltransferase 1 [Source:RefSeq peptide;Acc:NP_001165868]
Human Orthologue:
XYLT1
Human Description:
xylosyltransferase I [Source:HGNC Symbol;Acc:15516]
Mouse Orthologue:
Xylt1
Mouse Description:
xylosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2451073]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33177 Nonsense Mutation detected in F1 DNA During 2017
sa6892 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087118 Nonsense 190 919 2 11
Genomic Location (Zv9):
Chromosome 3 (position 26548508)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26338464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGATCTTCACCAGAGAGCCAATCCCACCCTCCGCCCACAGCAATCCCAG[C/T]AACACCGGCACCACTTCCAGCGACCCAAGCGATCGATCACACCCACTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087118 Nonsense 423 919 6 11
Genomic Location (Zv9):
Chromosome 3 (position 26571681)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26315291
KASP Assay ID:
554-4705.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATTTGCATTGTTRAAAATTGCCAACAGATTCATCAGAAAACAGGGTT[T/A]GGACCGGCTTTTCTTTGARTGCGACACCCATATGTGGCGGCTTGGAGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link