si:ch211-49j11.1

Ensembl ID:
ENSDARG00000061243
ZFIN ID:
ZDB-GENE-060526-172
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BFG9]
Human Orthologue:
UBASH3B
Human Description:
ubiquitin associated and SH3 domain containing B [Source:HGNC Symbol;Acc:29884]
Mouse Orthologue:
Ubash3b
Mouse Description:
ubiquitin associated and SH3 domain containing, B Gene [Source:MGI Symbol;Acc:MGI:1920078]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6983 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33625 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11071 Nonsense Available for shipment Available now
sa40459 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6982 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087128   None 599 None 13
ENSDART00000143434 Essential Splice Site 43 643 1 14
Genomic Location (Zv9):
Chromosome 5 (position 31490052)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29251409
KASP Assay ID:
554-5412.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACAGCCTGGATGTTTTGCTGTCAATGGGCTTCCCAAAAACCAGGGCG[T/C]AAGTACCAGMGTTTCATCTCGAGCATCACGCAGCTGTAATCACAGCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087128   None 599 None 13
ENSDART00000143434 Essential Splice Site 43 643 2 14
Genomic Location (Zv9):
Chromosome 5 (position 31519973)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTGTTAC[A/T]GGCTAAAAGCTCTGGTTTCGACTGGGGGCAGAAATGTACAAGCAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087128 Nonsense 339 599 7 13
ENSDART00000143434 Nonsense 383 643 8 14
Genomic Location (Zv9):
Chromosome 5 (position 31529838)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29291195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCTGCGCCCCAATCAGTCTCTGTTGCCTAAGAGGACTCTGTTTGTGTG[T/A]CGCCATGGTGAAAGAATGGATGTAGTGTTTGGGAAACATTGGATCACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087128 Essential Splice Site 362 599 8 13
ENSDART00000143434 Essential Splice Site 406 643 9 14
Genomic Location (Zv9):
Chromosome 5 (position 31531947)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29293304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAATGTTTAATAGTTATAAATGAGTGTTCTTGTTTTGTTTATTGAGC[A/T]GGTCGATATGTGCGGTCAAACCTCAATATGCCTCTGAGTCTCCCAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087128 Nonsense 457 599 10 13
ENSDART00000143434 Nonsense 501 643 11 14
Genomic Location (Zv9):
Chromosome 5 (position 31532468)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29293825
KASP Assay ID:
554-5158.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTAAGATCAGAGTTGMGCCAGGTTTGTTTGAGTGGACTAAATGGGTGT[C/A]KGGTACCTCATTACCTGCCTGGATYCCTCCTACAGATCTGGCAGCTGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link