cbln4

Ensembl ID:
ENSDARG00000061240
ZFIN ID:
ZDB-GENE-080204-58
Description:
cerebellin-4 [Source:RefSeq peptide;Acc:NP_001103861]
Human Orthologue:
CBLN4
Human Description:
cerebellin 4 precursor [Source:HGNC Symbol;Acc:16231]
Mouse Orthologue:
Cbln4
Mouse Description:
cerebellin 4 precursor protein Gene [Source:MGI Symbol;Acc:MGI:2154433]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8024 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19335 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087148 Essential Splice Site 134 199 2 3
ENSDART00000087148 Essential Splice Site 134 199 2 3
Genomic Location:
Chromosome 23 (position 38064264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTTTAAYTTCCACRTTATTAAAGTGTACCAGAGCCAGACTAKACAGG[T/C]GAGCAAAGCTTTTATGTGNNNNNTACAGAAAGACAATATTTGATCGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19335
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087148 Essential Splice Site 134 199 2 3
ENSDART00000087148 Essential Splice Site 134 199 2 3
Genomic Location:
Chromosome 23 (position 38064264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTTAACTTCCACGTTATTAAAGTGTACCAGAGCCAGACTATACAGG[T/C]GAGCAAAGCTTTTATGTGTTTCTTACAGAAAGACAATATTTGATCGCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3x6bvy7d