alg5

Ensembl ID:
ENSDARG00000061235
ZFIN ID:
ZDB-GENE-030131-6586
Description:
dolichyl-phosphate beta-glucosyltransferase [Source:RefSeq peptide;Acc:NP_001038819]
Human Orthologue:
ALG5
Human Description:
asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisia
Mouse Orthologue:
Alg5
Mouse Description:
asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase) Gene

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21777 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087114 Essential Splice Site 257 323 None 10
ENSDART00000131279 Essential Splice Site 225 291 None 10

The following transcripts of ENSDARG00000061235 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 36008695)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATATTATGGCAACTTTAATTCAATAATCCTTTATTTTGTAATTGTTGC[A/T]GGGCGTTTGATGTGGAGCTTCTCTTCATTGCTCAGTGTTTTGATATCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v1rhohmh